Nucleotide sequence of Mycobacterium leprae elongation factor (EF-Tu) gene.

The elongation factor EF-Tu is essential in bacterial translation and has sequences which are highly conserved even in phylogenetically distant bacteria. This allowed us to show that Gram negative bacteria had two copies of the tuf gene whereas most Gram positive bacteria including Mycobacteria had one copy of this gene (1). The agent of leprosy, Mycobacterium leprae, has been isolated from naturally infected Man, Armadillo and Mangabey monkey. Basic knowledge on the genetics of this organism is faint and comparison of strains isolated from different host is difficult (2). A genomic library of Mycobacterium leprae isolated from a naturally infected Mangabey monkey {Cercocebus spp.) was prepared in lambda Dash vector (Stratagene, USA). The library was screened with a 30 bp oligonucleotide probe (CAACAACTACCGTCCGCAGTTCTACTTCCG) deduced (3) from the sequences of a conserved region of the elongation factor gene in Eubacteria (GenBank M17788 and GenBank J01717). One recombinant phage with a 15 kb insert which hybridized with the probe was further digested with BamHI to produce a 9 kb fragment containing the tuf gene. This DNA fragment was subcloned into BLS plasmid (Stratagene, USA) for sequence determination (4). The resulting DNA sequence (done on both strands) revealed an open reading frame (nucleotides 94—1299) containing a typical translation initiation site, including a putative Shine—Dalgarno consensus sequence (GGAGG) at -13 from the start codon GUG (5, 6) at position 108 and a stop codon (UAA) at position 1296. The M.leprae DNA sequence was compared (3) to that of the elongation factor of M. leprae isolated from a Man (EMBL Z14314), of M.tuberculosis (GenBank S40925, X63539), of Micrococcus luteus (GenBank M17788) and of Escherichia colt (GenBank JO 1717). The comparison showed identity of 99.5%, 88%, 78% and 72% respectively. Out of 1191 basis, we found 6 differences with the sequence previously reported of M.leprae tuf gene, (7): 2 missing basis (one C after basis 564, one G after basis 946), 2 additional basis (G at basis 493 and G at basis 950), and 2 inverted basis (GC instead of CG at position 1154-1155).